Dr. Reichler’s Bio 301L  1-2pm        Print Name:_______    KEY  _______  ___
In-class Exam #1  September 23, 2002

    Answer each question as succinctly as possible in the space provided.  If needed, continue on the back.  If you use a drawing as part of your answer, be sure to also include a written explanation.  Read each question carefully and don’t hesitate to ask if a question seems unclear.  These questions have specific answers, although for some, more than one answer is possible.  To receive full credit you must clearly and fully answer the question being asked.  Each question is worth 6 pts, unless otherwise noted, for a total of 100 points possible for this exam.

1. If calcium has 20 protons, how many electrons does it normally have, and how many electrons does it have if it is positively charged?
Normal=20, pos=19

2. a.  Where are the covalent and ionic bonds in a glass of water?
Covalent bonds holding H2O together, ionic bonds between H and O on separate molecules giving water tension.

b. At the molecular level, what are two differences between liquid water and ice (solid water)?
Any two of:
Liquid-  rapid moving molecules, more dense, shapeless, molecules move past each other
Solid-  slower moving molecules, less dense, definite shape, molecules in crystal

3. Proteins are often functional only at a certain pH.  How might different pHs affect the function of a protein?
Differ pHs have different number of H+/H3O/OH groups, each having a charge.  Different charges could effect the ionic bands giving the protein its 3-D structure.

4. a.  What are two places in the cell where carbohydrates would be found?  What is the function of the carbohydrate in each place?
Any two of:  Mitochondria, used to make energy.  Chloroplast, being produced via photosynthesis.  Cell Wall/ extracellular matrix, protecting, supporting cell.

b. Would the distribution of carbohydrates be different between a plant and animal cell?  Explain.
Yes, Plant cell walls are made of cellulose, a carb; animal extracellular matrix is made of protein OR plant cells have chloloroplasts which make carbs.

5. What information is contained in DNA, and how does DNA specify the product?
Information is the production of proteins.  The order of nucleotides specify the order of amino acids that comprise the protein.

6. a.  Proteins involved in transport across membranes need to span the membrane.  In other words, the protein is imbedded in the membrane.  What characteristics would you expect for the amino acids that are in the middle of the membrane?
Internal membrane proteins should be hydrophobic or non-polar.

b. Can an organism without a membrane be considered alive?  Why or why not?
If it is organized, has metabolism, is self-replicating, can evolve, and reacts to the environment…yes, if not…no.

7. a.  Why does DNA need to be replicated?
When a cell divides, it needs to pass on a copy of the DNA to each cell.

b. DNA is a double-stranded molecule.  RNA is involved in the replication process, but not present in the DNA after replication.  Why is RNA needed, and how is it removed so as not to be present at the end of replication?
To act as a primer, DNA polymerase can only recognize a double strand with a single strand hanging off.  DNA pol removes the RNA primer and polymerase  puts DNA in its place.

8. a. If a long sequence of DNA (millions or billions of bases long) was replicated, would you expect that the copy would be exactly like the original?  Why or why not?
No, replication errors cause the copy to be different from the original.  OR the lagging strand has a gap at the end where the last RNA primer could not be replaced.

b. Why do most adult human cells lack telomerase?
They are not dividing and are not losing DNA at end, so do not need to add telomere via telomerase.  To stop the cells from dividing so that they don’t start accumulating mutations

9. a.  What are three differences between messenger RNA (mRNA) in the nucleus and the cytoplasm?
Any three of:  cytoplasmic mRNA-  lacks introns, has a poly-A tail, has a 5’ G cap, is attached to ribosome

b. Using the genetic code attached to the test, write the correct amino acid sequence that would be made from the following mRNA.
AUGCCCGUUACGGUCUGACGAUGG
  Met, Pro, Val, Thr, Val,  if add Stop (-1 point)

10. Using rules 1 and 2 of Strong Inference (the parts prior to actually doing any experiments), answer the following question…What is the purpose of the extra (junk) DNA in human cells?
(10 pts)
This answer must include multiple hypotheses, and an experiment designed to eliminate one of the hypotheses.
Example:  Hypo’s-  Has no purpose.  Has a purpose.  Expt.  Remove extra DNA from a human cell.  See if it is normal or not.